next up previous contents
Next: SELEX alignment format Up: FASTA unaligned sequence Previous: FASTA unaligned sequence

Example of a simple FASTA file

> seq1 This is the description of my first sequence.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCA
CGACGTAGATGCTAGCTGACTCGATGC
> seq2 This is a description of my second sequence.
CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAG
CATCGTCAGTTACTGCATGCTCG

FASTA is probably the simplest of formats for unaligned sequences. FASTA files are easily created in a text editor. Each sequence is preceded by a line starting with >. The first word on this line is the name of the sequence. The rest of the line is a description of the sequence (free format). The remaining lines contain the sequence itself. You can put as many letters on a sequence line as you want.

Blank lines in a FASTA file are ignored, and so are spaces or other gap symbols (dashes, underscores, periods) in a sequence. Any other non-amino or non-nucleic acid symbols in the sequence should produce an appropriately strident string of warnings on yur terminal screen when you try to use the file.



Sean Eddy
Mon Apr 17 09:54:19 CDT 1995